Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of FruR regulog to Staphylococcus aureus subsp. aureus str. Newman

Reference regulog properties
Source regulog: FruR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-6-phosphate
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus str. Newman
Orthologous TF(s) NWMN_0667
Regulated genes 1
Built upon 18 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus str. Newman
Locus tag Position Score Sequence
Position: -83
Score: 5.2
Sequence: TGAGTGTTTGTGATTGTTTT
Position: -73
Score: 5.3
Sequence: TGATTGTTTTTGGTAATTTA
Position: -63
Score: 5.6
Sequence: TGGTAATTTATGATTGAAAA
Locus tag: NWMN_0667
NWMN_0667 -83 5.2 TGAGTGTTTGTGATTGTTTT
-73 5.3 TGATTGTTTTTGGTAATTTA
-63 5.6 TGGTAATTTATGATTGAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fruR
Ortholog function: Transcriptional repressor of the fructose operon, DeoR family
Staphylococcus aureus subsp. aureus N315 SA0653 -83 4.9 TGGGTGTTTGTGATTGTTTT
-73 5.3 TGATTGTTTTTGGTAATTTA
-63 5.6 TGGTAATTTATGATTGAAAA
Staphylococcus capitis SK14 STACA0001_0331 -86 5.7 TGAATGTTTTTGATTGTTTG
-76 5.4 TGATTGTTTGTGATAATTTA
-66 5.9 TGATAATTTATGATTGAAAA
Staphylococcus epidermidis ATCC 12228 SE0470 -88 6.4 TGATTGTTTTTGATTGAAAA
-68 5.5 TGGAAGATTTTGATTGAAAT
Staphylococcus carnosus subsp. carnosus TM300 Sca_0346 -84 6.2 TGATTGTTTTTGAATGAAAA
-64 5.9 TGAAAGATTTTGATTGAAAA
Staphylococcus haemolyticus JCSC1435 SH2196 -85 5.8 TGAATGTTTTTGATTGTTTT
-75 5.1 TGATTGTTTTTGACAATTTG
-65 5.7 TGACAATTTGTGATTGAAAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP2019 -84 5.7 TGACTGTTTTTGATTGTTTT
-74 5.6 TGATTGTTTTTGACGAAAAA
Macrococcus caseolyticus JCSC5402 MCCL_0452 -88 5 TCTCTTTTTTTGATTGTAAA
-78 5 TGATTGTAAATGAATGAATT
-68 4.9 TGAATGAATTTGGTTGACAT