Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of BirA regulog to Staphylococcus aureus subsp. aureus str. Newman

Reference regulog properties
Source regulog: BirA - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: BirA
Regulation mode: repressor
Biological process: Biotin biosynthesis
Effector: Biotin
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus str. Newman
Orthologous TF(s) NWMN_1367
Regulated genes 2
Built upon 21 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus str. Newman
Locus tag Position Score Sequence
Position: -75
Score: 7.5
Locus tag: NWMN_2182
Supported by regulated orthologs from reference regulons
Ortholog gene name: bioY
Ortholog function: biotin transporter BioY
Staphylococcus aureus subsp. aureus N315 SA2077 -75 7.5 ATTGTAAACTTTTCATTTCTTAAAGTTTACAAT
Staphylococcus capitis SK14 STACA0001_1211 -70 7.8 TATGTAAACTTTTTATTTCTTAAAGTTTACATT
Staphylococcus epidermidis ATCC 12228 SE1856 -70 6.9 ATTGTAAACTTTCCATTCATAAAAGTTTACAAG
Staphylococcus carnosus subsp. carnosus TM300 Sca_1775 -75 7.3 AATGTAAACTTTTAGTAAATTCAAGTTAACAAT
Staphylococcus haemolyticus JCSC1435 SH0770 -69 8.2 AATGTAAACTTTTTATTTTATAAAGTTTACATT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0625 -67 8.1 AATGTAAACTTTTTATTTTTTAAAGTTTACATT
Macrococcus caseolyticus JCSC5402 MCCL_0134 -75 6.7 ATTGTTAACTTTTTGTACTAAAAGGTTAACGAA
Position: -54
Score: 7.9
Locus tag: NWMN_2326
Supported by regulated orthologs from reference regulons
Ortholog gene name: bioD
Ortholog function: dethiobiotin synthetase
Staphylococcus aureus subsp. aureus N315 SA2215 -55 7.9 AATGTAAACTTATTAATTATAAAAGTTTACATT
Staphylococcus epidermidis ATCC 12228 SE0179 -55 7.7 AATGTAAACTTTAAAATGTAATAAGTTTACATT
Staphylococcus carnosus subsp. carnosus TM300 Sca_2224 -73 8 AATGTAAACTTATAAAAATTAAAAGTTTACATT