Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of ArsR regulog to Staphylococcus aureus subsp. aureus str. Newman

Reference regulog properties
Source regulog: ArsR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate; Arsenite
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus str. Newman
Orthologous TF(s) NWMN_1664
Regulated genes 1
Built upon 26 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus str. Newman
Locus tag Position Score Sequence
Position: -40
Score: 6.9
Locus tag: NWMN_1664
Supported by regulated orthologs from reference regulons
Ortholog gene name: arsR
Ortholog function: arsenical resistance operon repressor
Staphylococcus aureus subsp. aureus N315 SA1591 -56 6.2 AATATAGACATTCATCTATATA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP2384 -56 5.4 AATATAGACACCAATCTATATA