Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of MntR regulog to Staphylococcus aureus subsp. aureus USA300_FPR3757

Reference regulog properties
Source regulog: MntR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus USA300_FPR3757
Orthologous TF(s) SAUSA300_0621
Regulated genes 2
Built upon 15 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus USA300_FPR3757
Locus tag Position Score Sequence
Position: -42
Score: 6.1
Locus tag: SAUSA300_0620
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntA
Ortholog function: manganese ABC transport system ATPase component MntA
Staphylococcus aureus subsp. aureus N315 SA0589 -42 6.1 TAATTAGGTTAGCCTAAACT
Staphylococcus capitis SK14 STACA0001_0395 -42 6.1 AAATTAGGTTAGCCTAAACT
Staphylococcus epidermidis ATCC 12228 SE0407 -42 6.4 AAATTAGGTTAACCTAAACT
Staphylococcus carnosus subsp. carnosus TM300 Sca_0275 -141 6.2 AAATTAGGTTAGCCTAAAAA
Staphylococcus haemolyticus JCSC1435 SH0143 -40 6.4 AAATTAGGTTAACCTAAACT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP2086 -40 6.2 AAATTAGGTTAGCCTAAAAA
Macrococcus caseolyticus JCSC5402 MCCL_0095 -52 5.9 AGTTTAGGTTTGCCTAAAAT
Position: -67
Score: 6.3
Locus tag: SAUSA300_1005
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntH
Ortholog function: Mn2+/Fe2+ transporter, NRAMP family
Staphylococcus aureus subsp. aureus N315 SA0956 -67 6.3 AATTTAGGTTGACCTAAACA
Staphylococcus capitis SK14 STACA0001_2258 -66 6.1 TTTTTAGGTTGACCTAACTT
Staphylococcus epidermidis ATCC 12228 SE0803 -51 6.3 TTTTTAGGTTGACCTAATAT
Staphylococcus carnosus subsp. carnosus TM300 Sca_0731 -76 6.1 TTTTTAGGTTGACCTAACTT
Staphylococcus haemolyticus JCSC1435 SH1847 -65 6.3 TTATTAGGTTGACCTAAAAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1685 -73 6.3 TTTTTAGGTTGACCTAATAA
Macrococcus caseolyticus JCSC5402 MCCL_0368 -52 5.7 TTTTTAGGTTGCCCTAAAGA