Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of FruR regulog to Staphylococcus aureus subsp. aureus USA300_FPR3757

Reference regulog properties
Source regulog: FruR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-6-phosphate
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus USA300_FPR3757
Orthologous TF(s) SAUSA300_0683
Regulated genes 1
Built upon 18 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus USA300_FPR3757
Locus tag Position Score Sequence
Position: -83
Score: 5.2
Position: -73
Score: 5.3
Position: -63
Score: 5.6
Locus tag: SAUSA300_0683
Supported by regulated orthologs from reference regulons
Ortholog gene name: fruR
Ortholog function: Transcriptional repressor of the fructose operon, DeoR family
Staphylococcus aureus subsp. aureus N315 SA0653 -83 4.9 TGGGTGTTTGTGATTGTTTT
Staphylococcus capitis SK14 STACA0001_0331 -86 5.7 TGAATGTTTTTGATTGTTTG
Staphylococcus epidermidis ATCC 12228 SE0470 -88 6.4 TGATTGTTTTTGATTGAAAA
Staphylococcus carnosus subsp. carnosus TM300 Sca_0346 -84 6.2 TGATTGTTTTTGAATGAAAA
Staphylococcus haemolyticus JCSC1435 SH2196 -85 5.8 TGAATGTTTTTGATTGTTTT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP2019 -84 5.7 TGACTGTTTTTGATTGTTTT
Macrococcus caseolyticus JCSC5402 MCCL_0452 -88 5 TCTCTTTTTTTGATTGTAAA