Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of CymR regulog to Staphylococcus aureus subsp. aureus USA300_FPR3757

Reference regulog properties
Source regulog: CymR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus USA300_FPR3757
Orthologous TF(s) SAUSA300_1583
Regulated genes 12
Built upon 69 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus USA300_FPR3757
Locus tag Position Score Sequence
Position: -68
Score: 4.8
Position: -59
Score: 4.9
Locus tag: SAUSA300_0173
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA0165
Ortholog function: hypothetical protein
Staphylococcus aureus subsp. aureus N315 SA0165 -59 4.9 GTAATCCGATAAGAATTATAGTAATAT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0460 -69 4.8 CATATCCTTGTAATCTGATAAGATTTA
Position: -77
Score: 4.8
Locus tag: SAUSA300_0200
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA0198
Ortholog function: oligopeptide transport ATP-binding protein
Staphylococcus aureus subsp. aureus N315 SA0198 -77 4.8 TAATCTTGAGTAGATTACTATGATATA
Position: -54
Score: 5.8
Locus tag: SAUSA300_0382
Supported by regulated orthologs from reference regulons
Ortholog gene name: tcyP
Ortholog function: L-cystine uptake protein tcyP
Staphylococcus aureus subsp. aureus N315 SA0368 -54 5.8 TTATTCTTAGCATACTAGTCGGAATTA
Staphylococcus capitis SK14 STACA0001_1450 -57 5.1 ATATCCTTATTATATATGTCGGAATAC
Staphylococcus epidermidis ATCC 12228 SE2354 -56 5.3 TTATTCTTATTACATATGTCGGAATAC
Staphylococcus carnosus subsp. carnosus TM300 Sca_0042 -269 5 TAAATACGATATATTTACTAAGGATTT
Staphylococcus haemolyticus JCSC1435 SH2589 -49 5.4 TTATCCTTATTAAGTATGTCGGAATTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP2329 -63 4.6 ATATCCTTAGTATACGTATCGGATTTC
Macrococcus caseolyticus JCSC5402 MCCL_0267 32 5.5 TAATTCTTAgTAtTcTtATAGGAtTac
Position: -88
Score: 5.8
Locus tag: SAUSA300_0433
Supported by regulated orthologs from reference regulons
Ortholog gene name: mccA
Ortholog function: cystathionine beta-synthase
Staphylococcus aureus subsp. aureus N315 SA0418 -88 5.8 TAATTCTTATCTGAAAAGTAAGAATTA
Staphylococcus capitis SK14 STACA0001_1480 -96 5.4 TAATTCATACCTGATAAGTAAGAATTT
Staphylococcus epidermidis ATCC 12228 SE2324 -96 5.7 TAATTCATATCTGATAAGTAAGAATTA
Staphylococcus carnosus subsp. carnosus TM300 Sca_0086 -92 5.6 TAATCCATATCAGTATAGTAGGAATAA
Staphylococcus haemolyticus JCSC1435 SH2549 -109 5.4 TAATTCATAGTGATTGAGTAAGAATTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0252 -144 5.1 GTATGCTTACTGAAAAAGTAGGAATTA
Macrococcus caseolyticus JCSC5402 MCCL_1789 -46 5.6 TAATCCCGAGTTATCTGATAAGAATAA
Position: -42
Score: 5.8
Locus tag: SAUSA300_0435
Supported by regulated orthologs from reference regulons
Ortholog gene name: metN2
Ortholog function: methionine ABC transporter paralog, ATP-binding protein MetN2
Staphylococcus aureus subsp. aureus N315 SA0420 -42 5.8 TTATTCCTAGTGGATTAATAAGAATTT
Staphylococcus capitis SK14 STACA0001_1483 -43 5.4 ATATTCAGATAAGTATAATCAGAATTG
Staphylococcus epidermidis ATCC 12228 SE2322 -42 5.3 ATATTCAGATAATTTTAATCGGAAATT
Position: -55
Score: 5.1
Locus tag: SAUSA300_0491
Supported by regulated orthologs from reference regulons
Ortholog gene name: cysK
Ortholog function: cysteine synthase
Staphylococcus aureus subsp. aureus N315 SA0471 -55 5.1 TATATCCGATAAATAAACTAAGATTTC
Staphylococcus capitis SK14 STACA0001_2088 -57 4.9 TATATCCGATAGGAAAACTAAGTTTTA
Staphylococcus epidermidis ATCC 12228 SE2270 -58 4.8 TATATCCGATAGAAAAACTAAGTATTG
Staphylococcus carnosus subsp. carnosus TM300 Sca_0164 -143 4.4 GATATCCGATGAAATAGCTAAGATATA
Staphylococcus haemolyticus JCSC1435 SH2497 -56 4.9 TATATCCGATAGAAAAACTAAGTTTTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP2243 -55 5.1 TATATCCGATTGAAAAAGTAGGTTTTA
Macrococcus caseolyticus JCSC5402 MCCL_1900 -50 5.4 TAAATCCGATAAGCGTAATAAGAATAA
Position: -40
Score: 5.2
Locus tag: SAUSA300_1998
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA1850
Ortholog function: putative transporter for thiosulphate
Staphylococcus aureus subsp. aureus N315 SA1850 -40 5.2 TAATACATACTAAACTTATCGGAAATG
Staphylococcus carnosus subsp. carnosus TM300 Sca_1551 -38 4.8 TAAAACTTACTAACATTATCGGAAAAG
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0834 -37 5.1 TTAATCTTATTGATTTTATCGGGAAAG
Position: -244
Score: 4.8
Locus tag: SAUSA300_2088
Supported by regulated orthologs from reference regulons
Ortholog gene name: luxS
Ortholog function: S-ribosylhomocysteinase
Staphylococcus aureus subsp. aureus N315 SA1936 -244 4.8 GAATTATTACTTATTCTATCGGTTTTA
Staphylococcus capitis SK14 STACA0001_0838 -193 5.5 TAATTATTACTTATTCTATCGGAATAA
Staphylococcus epidermidis ATCC 12228 SE1732 -182 5.6 TAATTATTACTTATTTTATCGGATTTA
Staphylococcus carnosus subsp. carnosus TM300 Sca_1637 -110 4.7 TTATCCCGAGTAAACTTATCAACTTAA
Staphylococcus haemolyticus JCSC1435 SH0901 -182 5.6 TAATTATTACTTATTTTATCGGATTTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0751 -159 5.1 TAATTATTACTTATTCTATCGGGTTTA
Macrococcus caseolyticus JCSC5402 MCCL_1791 -46 5.6 TAATCCCGAGTTATCTGATAAGAATAA
Position: -62
Score: 4.6
Locus tag: SAUSA300_2236
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA2080
Ortholog function: putative acyl-CoA dehydrogenase
Staphylococcus aureus subsp. aureus N315 SA2080 -62 4.6 TAAAGTCGAGTGTTAAACTAGGAATAA
Staphylococcus capitis SK14 STACA0001_1208 -57 4.2 AAAAGTCGAGTGTTAAACTAGGATTAA
Staphylococcus epidermidis ATCC 12228 SE1858 -65 4.4 TAAAGTCGAGTGTTAAACTATGAATAA
Staphylococcus carnosus subsp. carnosus TM300 Sca_1777 -56 4.4 TTAATCCGAGTGATACACTAAACTTAA
Staphylococcus haemolyticus JCSC1435 SH0767 -266 4.4 TAATGTCGAGTGATAAACTAGGTTTAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0622 -110 5.1 TAAATCTTATCGGTAAAGTAAGGATTT
Macrococcus caseolyticus JCSC5402 MCCL_0131 -256 4.5 TATTTCCTAGATAATAAATAATGTATT
Position: -40
Score: 6.2
Locus tag: SAUSA300_2359
Supported by regulated orthologs from reference regulons
Ortholog gene name: tcyA
Ortholog function: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
Staphylococcus aureus subsp. aureus N315 SA2202 -40 6.2 TTATTCCGATTAGAATAATAAGAATAA
Staphylococcus capitis SK14 STACA0001_1063 -40 6 TTATTCCGATTAGAATAATAAGATTAA
Staphylococcus epidermidis ATCC 12228 SE1993 -40 6.2 TTATTCCGATTAGAATAATAAGAATAA
Staphylococcus carnosus subsp. carnosus TM300 Sca_1910 -40 5.4 TTATTCCGATGAGAATGATAAGGATAA
Staphylococcus haemolyticus JCSC1435 SH0639 -41 5.9 TTATTCTGACTAATCTAATAGGAATAT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0242 -37 5.8 TTATTCCGATAAGAATAATAAGAATAG
Macrococcus caseolyticus JCSC5402 MCCL_1425 -38 5.3 CTATTCCGAGTAAATTGATATGAATAG
Position: -258
Score: 4.7
Locus tag: SAUSA300_2554
Supported by regulated orthologs from reference regulons
Ortholog gene name: cysJ
Ortholog function: sulfite reductase [NADPH] flavoprotein, alpha-component
Staphylococcus aureus subsp. aureus N315 SA2413 -257 4.7 TAATAAATAGTAAATAAATAAAAAATA
Staphylococcus capitis SK14 STACA0001_1811 -246 4.7 TAAAGCATAGTATTCCGATAAGATATA
Staphylococcus epidermidis ATCC 12228 SE2180 -273 4.7 CAAAACATAGTATTCCGATAAGAAATA
Staphylococcus carnosus subsp. carnosus TM300 Sca_0059 -134 5.4 TAATTCTTAGTAAACCTATTGGAATTA
Staphylococcus haemolyticus JCSC1435 SH0414 -152 4.5 TAAAACATAGTATTCTGATATGTTTTG
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP2408 -152 4.5 AATAACCTAGTATTCGTATCGGAAATA