Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of CggR regulog to Staphylococcus aureus subsp. aureus USA300_FPR3757

Reference regulog properties
Source regulog: CggR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: SorC
Regulation mode: repressor
Biological process: Glycolysis
Effector: Fructose-1,6-diphosphate
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus USA300_FPR3757
Orthologous TF(s) SAUSA300_0755
Regulated genes 1
Built upon 7 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus USA300_FPR3757
Locus tag Position Score Sequence
Position: -85
Score: 6.9
Sequence: TTTTGTCCCACGCGGGACTTAA
Locus tag: SAUSA300_0755
SAUSA300_0755 -85 6.9 TTTTGTCCCACGCGGGACTTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: cggR
Ortholog function: Transcriptional regulator of central glycolytic gene, SorC family
Staphylococcus aureus subsp. aureus N315 SA0726 -85 6.9 TTTTGTCCCACGCGGGACTTAA
Staphylococcus capitis SK14 STACA0001_0256 -91 6.7 TTTTGTCCCAGGTGGGACTTAA
Staphylococcus epidermidis ATCC 12228 SE0556 -91 6.7 TTTTGTCCCAGGTGGGACTTAA
Staphylococcus carnosus subsp. carnosus TM300 Sca_0423 -77 6.7 TTTTGTCCCACCCGGGACTTAA
Staphylococcus haemolyticus JCSC1435 SH2114 -81 6.7 TTTTGTCCCGCGCGGGACACAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1917 -78 5.9 TTTTGTCCTGCTAGGGACGTAA
Macrococcus caseolyticus JCSC5402 MCCL_0520 -47 5.9 TTTTGACCCGAGTGGGACGAAT