Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of ScrR regulog to Staphylococcus aureus subsp. aureus COL

Reference regulog properties
Source regulog: ScrR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus COL
Orthologous TF(s) SACOL2030
Regulated genes 2
Built upon 16 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus COL
Locus tag Position Score Sequence
Position: -127
Score: 5.7
Locus tag: SACOL2029
Supported by regulated orthologs from reference regulons
Ortholog gene name: scrB
Ortholog function: sucrose-6-phosphate hydrolase
Staphylococcus aureus subsp. aureus N315 SA1846 -127 5.7 ATGTGGAACCGATACCATAT
Staphylococcus capitis SK14 STACA0001_2125 -207 5.8 ATTTGGAACCGATACCACTA
Staphylococcus epidermidis ATCC 12228 SE1640 -233 5.7 AAATGGAACCGATACCACAT
Staphylococcus haemolyticus JCSC1435 SH0991 -72 5.7 CTATGGAACCGATACCATAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0837 -58 6.2 AAATGGAACCGGTACCAAAA
Macrococcus caseolyticus JCSC5402 MCCL_0373 -30 6.1 AAATGGAACCGGTTCCAAAG
Position: -63
Score: 6.2
Locus tag: SACOL2376
Supported by regulated orthologs from reference regulons
Ortholog gene name: scrA
Ortholog function: PTS system sucrose-specific IIBC component
Staphylococcus aureus subsp. aureus N315 SA2167 -63 6.2 TTTTGGAACCGGTTACAATA
Staphylococcus capitis SK14 STACA0001_1097 -65 5.9 TCTTGGAACCGGTTACAATA
Staphylococcus epidermidis ATCC 12228 SE1959 -60 5.9 GATTGGAACCGGTTACAATA
Staphylococcus haemolyticus JCSC1435 SH0671 -65 6 TTTTGGAACCGGTTACAATG
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0512 -68 5.7 AGTTGGAACCGGTTACAATA