Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of Zur regulog to Staphylococcus aureus subsp. aureus NCTC 8325

Reference regulog properties
Source regulog: Zur - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus NCTC 8325
Orthologous TF(s) SAOUHSC_01655
Regulated genes 7
Built upon 56 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus NCTC 8325
Locus tag Position Score Sequence
Position: -42
Score: 6.8
Sequence: TAAATCGTAACTATTACGTTTTA
Locus tag: SAOUHSC_00882
SAOUHSC_00882 -42 6.8 TAAATCGTAACTATTACGTTTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA0806
Ortholog function: hypothetical protein
Staphylococcus aureus subsp. aureus N315 SA0806 -42 6.4 TAAATCGTAACGATTACGCTTTA
Staphylococcus capitis SK14 STACA0001_0181 -52 6.8 TAAATAGTAATTATTTCGATTTA
Staphylococcus epidermidis ATCC 12228 SE0639 -42 7.2 TAAATCGTAATAATTACGTTTTA
Staphylococcus carnosus subsp. carnosus TM300 Sca_0550 -36 7 TAAATCGAAATTATTACGATTTA
Staphylococcus haemolyticus JCSC1435 SH2006 -42 7.2 TAAATCGTAATTATTACGTTTTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1830 -40 7.4 TAAATCGTAATTATTACGATTTA
Position: -38
Score: 5.4
Sequence: TAAATCGTAAAGATTCCTAACAA
Locus tag: SAOUHSC_01328
SAOUHSC_01328 -38 5.4 TAAATCGTAAAGATTCCTAACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rpmG2
Ortholog function: 50S ribosomal protein L33
Staphylococcus aureus subsp. aureus N315 SAS042 -38 5.4 TAAATCGTAAAGATTCCTAACAA
Staphylococcus capitis SK14 STACA0001_1578 -43 5.3 TAAATCGTAAGAATTCCTAACAA
Staphylococcus epidermidis ATCC 12228 SE1017 -43 5.3 TAAATCGTAAGAATTCCTAACAA
Staphylococcus carnosus subsp. carnosus TM300 Sca_0976 -227 6.7 ATAATCGTAATTATTACGATTTA
Staphylococcus haemolyticus JCSC1435 SH1572 -43 6.5 TAAATCGTAAGTATTCCTATTTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1422 -39 7.1 TAAAACGTAATAATTACTATTTA
Position: -45
Score: 7.1
Sequence: TAAATCGTAATAATTACGATTTG
Locus tag: SAOUHSC_01329
SAOUHSC_01329 -45 7.1 TAAATCGTAATAATTACGATTTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: rpsN2
Ortholog function: 30S ribosomal protein S14
Staphylococcus aureus subsp. aureus N315 SA1171 -45 7.1 TAAATCGTAATAATTACGATTTG
Staphylococcus capitis SK14 STACA0001_1579 -42 7.2 TAAAACGTAATAATTACGATTTA
Staphylococcus epidermidis ATCC 12228 SE1018 -42 6.9 TAAAACGTAATTATTACGATTTG
Staphylococcus carnosus subsp. carnosus TM300 Sca_0977 -54 6.7 TAAATCGTAATAATTACGATTAT
Staphylococcus haemolyticus JCSC1435 SH1571 -43 7.2 TAAAACGTAATAATTACGATTTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1421 -43 6.9 TAAAACGTAATAATTACGATTTG
Position: -51
Score: 5.5
Sequence: TGAGTCGTAAACATTACTGTTTA
Locus tag: SAOUHSC_01657
SAOUHSC_01657 -51 5.5 TGAGTCGTAAACATTACTGTTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuC
Ortholog function: Zinc ABC transporter, ATP-binding protein ZnuC
Staphylococcus aureus subsp. aureus N315 SA1385 -69 5.5 TGAGTCGTAAACATTACTGTTTA
Staphylococcus capitis SK14 STACA0001_1794 -66 6.1 TTAGTCGTAAACATTACTATTTA
Staphylococcus epidermidis ATCC 12228 SE1243 -58 5.8 ATAGTCGTAAACATTACTATTTA
Staphylococcus carnosus subsp. carnosus TM300 Sca_1177 -65 6.2 TTAATCGTAAGCATTACAATTTA
Staphylococcus haemolyticus JCSC1435 SH1360 -66 6.2 CAAGTCGTAAACATTACTATTTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1200 -66 6.1 TAATTCGGAAACATTACTATTTA
Position: -34
Score: 6.6
Sequence: TAAAACGTAAAGATTACTATTTA
Locus tag: SAOUHSC_02690
SAOUHSC_02690 -34 6.6 TAAAACGTAAAGATTACTATTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: zinT
Ortholog function: Candidate zinc-binding lipoprotein ZinT
Staphylococcus aureus subsp. aureus N315 SA2194 -34 6.6 TAAAACGTAAAGATTACTATTTA
Staphylococcus capitis SK14 STACA0001_1070 -34 7.3 TAAATCGTAATAATTACTATTTA
Staphylococcus haemolyticus JCSC1435 SH0645 -34 7.3 TAAATCGTAATTATTACTATTTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0490 -36 6.9 TAAATCGTAACAATTACTATTTA
Position: -69
Score: 7.4
Sequence: TAAATCGTAATTATTACGATTTA
Locus tag: SAOUHSC_02904
SAOUHSC_02904 -69 7.4 TAAATCGTAATTATTACGATTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA2370
Ortholog function: hypothetical protein
Staphylococcus aureus subsp. aureus N315 SA2370 -69 7.4 TAAATCGTAATTATTACGATTTA
Staphylococcus epidermidis ATCC 12228 SE0191 -244 6.1 TAAATCGAAATTGTTACGCTTTA
-53 6.8 TAAATCGTAATAATTACGTTTTT
Staphylococcus carnosus subsp. carnosus TM300 Sca_1906 -83 6.4 TAAAACATAACGATTACGATTTA