Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of YtrA regulog to Staphylococcus aureus subsp. aureus NCTC 8325

Reference regulog properties
Source regulog: YtrA - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Hypothetical ABC transporter
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus NCTC 8325
Orthologous TF(s) SAOUHSC_02155
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus NCTC 8325
Locus tag Position Score Sequence
Position: -42
Score: 6.8
Locus tag: SAOUHSC_02155
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytrA
Ortholog function: transcription regulator GntR family
Staphylococcus aureus subsp. aureus N315 SA1748 -42 6.8 TGTGTATATTGTATATATACA
Staphylococcus capitis SK14 STACA0001_1986 -40 7 TGTATATATTATGTATATACA
Staphylococcus epidermidis ATCC 12228 SE1625 -40 7 TGTATATATTATGTATATACA
Staphylococcus carnosus subsp. carnosus TM300 Sca_1508 -128 6.9 TGTATATATACAATATATACA
Staphylococcus haemolyticus JCSC1435 SH1021 -127 6.4 TGTATCTATAATGTATATACA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0856 -40 6.7 TGTATATATTGCGTATATACA