Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of HisR regulog to Staphylococcus aureus subsp. aureus NCTC 8325

Reference regulog properties
Source regulog: HisR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus NCTC 8325
Orthologous TF(s) SAOUHSC_02125
Regulated genes 5
Built upon 24 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus NCTC 8325
Locus tag Position Score Sequence
Position: -30
Score: 5.5
Sequence: CGCTTTAACGCTTTAAAGGA
Locus tag: SAOUHSC_00420
SAOUHSC_00420 -30 5.5 CGCTTTAACGCTTTAAAGGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA0417
Ortholog function: putative sodium-dependent transporter
Staphylococcus aureus subsp. aureus N315 SA0417 -27 5.5 CGCTTTAACGCTTTAAAGGA
Staphylococcus capitis SK14 STACA0001_1477 -30 5.6 CACTTTAGCGCTTTAAAGGG
Staphylococcus epidermidis ATCC 12228 SE2326 -108 5.6 CACTTTAGCGCTTTAAAGGG
Staphylococcus carnosus subsp. carnosus TM300 Sca_0085 -143 5.7 CGCTTTAACGCTTTAAAGTA
Staphylococcus haemolyticus JCSC1435 SH2552 -108 5.9 CGCTTTAACGCGTTAAAGGG
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP2298 -47 5.1 CGCTTTAACGCAATAAAGCT
Macrococcus caseolyticus JCSC5402 MCCL_0041 -33 5.4 CACTTTACAGCGTTAAAACG
Position: -38
Score: 5.1
Sequence: CGCTTTAGTTCGATAGAGTG
Locus tag: SAOUHSC_00880
SAOUHSC_00880 -38 5.1 CGCTTTAGTTCGATAGAGTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yuiF
Ortholog function: Histidine permease
Staphylococcus aureus subsp. aureus N315 SA0804 -38 5 CGCTTTAGTTCGATAGAGCG
Staphylococcus capitis SK14 STACA0001_0183 -39 4.9 TACTTTAGTTCGATAGAGTG
Staphylococcus epidermidis ATCC 12228 SE0637 -37 4.9 TACTTTAGTTCGATAGAGTG
Staphylococcus carnosus subsp. carnosus TM300 Sca_0548 -37 4.2 TGCTTTAGTTCGATAACGTA
Staphylococcus haemolyticus JCSC1435 SH2008 -37 4.9 TACTTTAGTTCGGTAGAGAG
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1832 -38 4.5 TACTTTAGTTCGATAACGTG
Macrococcus caseolyticus JCSC5402 MCCL_0570 -47 4.2 TACTTTAGTATGCTAATATA
Position: -62
Score: 5.2
Sequence: CACTTTAATAGATTAATGCG
Locus tag: SAOUHSC_02125
SAOUHSC_02125 -62 5.2 CACTTTAATAGATTAATGCG
Supported by regulated orthologs from reference regulons
Ortholog gene name: hisR
Ortholog function: Predicted histidine repressor, TrpR family
Staphylococcus aureus subsp. aureus N315 SA1723 -62 5.2 CACTTTAATAGATTAATGCG
Staphylococcus capitis SK14 STACA0001_1960 -60 5.1 CACTTTAACTAATTAGTACG
Staphylococcus epidermidis ATCC 12228 SE1592 -60 5 CACTTTAACGAATTAGTAAG
Staphylococcus carnosus subsp. carnosus TM300 Sca_1481 -60 5.1 CACTTTAACGTATTAGTACG
Staphylococcus haemolyticus JCSC1435 SH1044 -65 5.4 CACTTTAACTATTTAATGCG
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0883 -61 5.1 CACTTTAATGTACTAATACG
Position: 30
Score: 3.9
Sequence: AATATTAGTAATGTAAAACG
Locus tag: SAOUHSC_03010
SAOUHSC_03010 30 3.9 AATATTAGTAATGTAAAACG
Supported by regulated orthologs from reference regulons
Ortholog gene name: hisH
Ortholog function: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
Staphylococcus aureus subsp. aureus N315 SA2467 -84 4.7 CACTTTAGTGTGGTAGAGAA
Staphylococcus epidermidis ATCC 12228 SE0274 -56 3.9 TACTTTAATGTATTATCGAA
Staphylococcus carnosus subsp. carnosus TM300 Sca_0632 -50 4.9 TACTTTAGTTCGGTAGAGAG
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0426 -49 4.6 TACTTTAGTTCGGTAGAGAA
Position: -84
Score: 4.8
Sequence: CACTTTAGCGTGGTAGAGAA
Locus tag: SAOUHSC_03015
SAOUHSC_03015 -84 4.8 CACTTTAGCGTGGTAGAGAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: hisZ
Ortholog function: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
Staphylococcus aureus subsp. aureus N315 SA2472 -84 4.7 CACTTTAGTGTGGTAGAGAA
Staphylococcus epidermidis ATCC 12228 SE0270 -56 3.9 TACTTTAATGTATTATCGAA
Staphylococcus carnosus subsp. carnosus TM300 Sca_0637 -50 4.9 TACTTTAGTTCGGTAGAGAG
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0431 -49 4.6 TACTTTAGTTCGGTAGAGAA