Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of MtlR regulog to Staphylococcus aureus subsp. aureus NCTC 8325

Reference regulog properties
Source regulog: MtlR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: activator
Biological process: Mannitol utilization
Effector: MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus NCTC 8325
Orthologous TF(s) SAOUHSC_02401
Regulated genes 1
Built upon 5 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus NCTC 8325
Locus tag Position Score Sequence
Position: -104
Score: 6.5
Locus tag: SAOUHSC_02400
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtlF
Ortholog function: mannitol specific PTS system, IIBC component
Staphylococcus aureus subsp. aureus N315 SA1960 -104 6.5 TTGTCACATTTATTTTGACAA
Staphylococcus capitis SK14 STACA0001_0858 -108 6.2 TTGTCACAAATATCATGACAA
Staphylococcus carnosus subsp. carnosus TM300 Sca_1658 -105 5.3 ATGGCAACAATTCAGTGACAA
Staphylococcus haemolyticus JCSC1435 SH0235 -105 6.8 TTGTCACAATTACTGTGACAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0728 -106 6.6 TTGTCAAAGATACTGTGACAA