Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of MalR regulog to Staphylococcus aureus subsp. aureus NCTC 8325

Reference regulog properties
Source regulog: MalR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus NCTC 8325
Orthologous TF(s) SAOUHSC_01602
Regulated genes 1
Built upon 5 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus NCTC 8325
Locus tag Position Score Sequence
Position: -66
Score: 6.7
Sequence: TTGTGCAAACGTTTTCACAA
Locus tag: SAOUHSC_00175
SAOUHSC_00175 -66 6.7 TTGTGCAAACGTTTTCACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mdxK
Ortholog function: Maltose/maltodextrin transport ATP-binding protein
Staphylococcus aureus subsp. aureus N315 SA0206 -66 6.7 TTGTGCAAACGTTTTCACAA
Macrococcus caseolyticus JCSC5402 MCCL_0361 -110 6.7 TTATGCAATCGTTTGCAAAA