Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of LexA regulog to Staphylococcus aureus subsp. aureus NCTC 8325

Reference regulog properties
Source regulog: LexA - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus NCTC 8325
Orthologous TF(s) SAOUHSC_01333
Regulated genes 10
Built upon 85 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus NCTC 8325
Locus tag Position Score Sequence
Position: -256
Score: 4.9
Sequence: CACAGAACGTTTGTTCGCTA
Locus tag: SAOUHSC_00740
SAOUHSC_00740 -256 4.9 CACAGAACGTTTGTTCGCTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA0684
Ortholog function: putative permease
Staphylococcus aureus subsp. aureus N315 SA0684 -124 4.8 CACAGAACGTTTGTTCGGTA
Position: -113
Score: 5.4
Sequence: TTACGAACAAACGTTTGCTT
Locus tag: SAOUHSC_00776
SAOUHSC_00776 -113 5.4 TTACGAACAAACGTTTGCTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: uvrB
Ortholog function: excinuclease ABC subunit B
Staphylococcus aureus subsp. aureus N315 SA0713 -107 5.4 TTACGAACAAACGTTTGCTT
Staphylococcus capitis SK14 STACA0001_0273 -126 5.4 AAGCGAACAAACGTTTGCTT
Staphylococcus epidermidis ATCC 12228 SE0541 -130 5.7 AAGCGAACAAATGTTTGTAT
Staphylococcus carnosus subsp. carnosus TM300 Sca_0407 -267 4.8 CTGCGAACAGATGTTTGTAC
Staphylococcus haemolyticus JCSC1435 SH2131 -266 5.5 AAGCGAACAAACGTTTGTAT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1959 -176 5.6 CTACGAACAAATGTTTGTTT
Macrococcus caseolyticus JCSC5402 MCCL_0509 -67 5.3 TTACGAACAAATGTTTGTAC
Position: -145
Score: 5.1
Sequence: ATAAGCACGTTTGTTCGTTT
Position: -102
Score: 5.4
Sequence: ATACGAACAAATATTCGCAA
Locus tag: SAOUHSC_01262
SAOUHSC_01262 -145 5.1 ATAAGCACGTTTGTTCGTTT
-102 5.4 ATACGAACAAATATTCGCAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: recA
Ortholog function: recombinase A
Staphylococcus aureus subsp. aureus N315 SA1128 -145 5.1 ATAAGCACGTTTGTTCGTTT
-102 5.4 ATACGAACAAATATTCGCAA
Staphylococcus capitis SK14 STACA0001_2334 -146 4.9 ATAAGTACGTTTGTTCGATT
-103 5.1 ACACGAACAAATATTCGCAA
Staphylococcus epidermidis ATCC 12228 SE0963 -145 5.1 ATAAGTACGTTTGTTCGTTT
-102 5.4 ATACGAACAAATATTCGCAA
Staphylococcus carnosus subsp. carnosus TM300 Sca_0926 -102 5 AATCGAACAAACATTCGCAA
Staphylococcus haemolyticus JCSC1435 SH1628 -105 5.2 AAGCGAACAAATATTCGCAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1480 -104 5.1 TAGCGAACAAATATTCGCAA
Macrococcus caseolyticus JCSC5402 MCCL_0875 -132 5.2 ATACAAACAGACGTTCGCAT
Position: -74
Score: 5.6
Sequence: TAACGAACAAATGTTTGTTT
Locus tag: SAOUHSC_01333
SAOUHSC_01333 -74 5.6 TAACGAACAAATGTTTGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: lexA
Ortholog function: SOS regulatory LexA protein
Staphylococcus aureus subsp. aureus N315 SA1174 -132 4.9 CCTAGAACATTTGTTTGTAT
-74 5.6 TAACGAACAAATGTTTGTTT
Staphylococcus capitis SK14 STACA0001_1582 -132 4.7 CCTAGAACGTTTGTTTGTAT
-103 4.8 ATCAGAACGAATGTTCTGTG
-74 5.7 AAACGAACAAACGTTTGTTT
Staphylococcus epidermidis ATCC 12228 SE1022 -517 4.9 cctaGAACATtTGTTtGTAT
-459 5.5 tTACGAACAaATGTTtGTta
Staphylococcus carnosus subsp. carnosus TM300 Sca_0980 -132 4.7 CCCAGAACATTTGTTTGCAT
-103 4.9 ATCAGAACGATTGTTCGCTG
-74 5.5 TTACGAACAAATGTTTGTAA
Staphylococcus haemolyticus JCSC1435 SH1568 -132 5 TCTAGAACATTTGTTTGTAT
-103 4.8 AACAGAACATCTGTTCTTAG
-74 5.4 AAACGAACAAATGTTTGTTC
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1418 -131 4.7 CCTAGAACGTTTGTTTGTAT
-102 4.9 ATCAGAACATTTGTTCTATG
-73 5.5 AAACGAACAAACGTTTGTAA
Macrococcus caseolyticus JCSC5402 MCCL_0995 -135 4.9 CCTAGAACATTTGTTTGTAT
-77 5.7 ATACGAACAAATGTTTGTTA
Position: -31
Score: 5.3
Sequence: AAGCGAACAAATGTTCTATA
Locus tag: SAOUHSC_01341
SAOUHSC_01341 -31 5.3 AAGCGAACAAATGTTCTATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: sbcD
Ortholog function: exonuclease SbcD
Staphylococcus aureus subsp. aureus N315 SA1180 -31 5.3 AAGCGAACAAATGTTCTATA
Staphylococcus capitis SK14 STACA0001_1593 -33 5.9 ATACGAACAAATGTTCTTAT
Staphylococcus epidermidis ATCC 12228 SE1028 -33 5.7 AAACGAACAAACGTTCTTAT
Staphylococcus haemolyticus JCSC1435 SH1562 -31 5.2 ACACGAACAAATGTTCTAAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1412 -33 5.2 ATACGAACAAACGTTCTAAG
Position: -38
Score: 5.3
Sequence: AAACGAACGTACGTTTGCAG
Locus tag: SAOUHSC_01351
SAOUHSC_01351 -38 5.3 AAACGAACGTACGTTTGCAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: parE
Ortholog function: DNA topoisomerase IV subunit B
Staphylococcus aureus subsp. aureus N315 SA1188 -32 5.3 AAACGAACGTACGTTTGCAG
Staphylococcus capitis SK14 STACA0001_1601 -33 5.4 AAACGAACGTACGTTTGTAG
Staphylococcus epidermidis ATCC 12228 SE1036 -33 5.2 TAACGAACGTACGTTTGTAG
Staphylococcus carnosus subsp. carnosus TM300 Sca_0995 -35 5.4 TAACGAACGTATGTTTGTAG
Staphylococcus haemolyticus JCSC1435 SH1554 -32 5.4 AAACGAACGTACGTTTGTAG
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1404 -33 5.4 AAACGAACGTACGTTTGTAG
Macrococcus caseolyticus JCSC5402 MCCL_1011 -31 5.2 TTTCGAACGTATGTTTGTAG
Position: -79
Score: 5
Sequence: AACAGAACATTTGTTCTAAA
Locus tag: SAOUHSC_01363
SAOUHSC_01363 -79 5 AACAGAACATTTGTTCTAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: uvrX
Ortholog function: Putative UV-damage repair protein
Staphylococcus aureus subsp. aureus N315 SA1196 -79 5 AACAGAACATTTGTTCTAAA
-51 4.8 AATAGAACACGTGTTCGTAT
Staphylococcus capitis SK14 STACA0001_1610 -78 5 AATAGAACATTCGTTCTTGT
-49 4.9 ATAAGAACACGTGTTCTTAT
Staphylococcus epidermidis ATCC 12228 SE1046 -77 5.7 ATAAGAACAAATGTTCTTAT
-48 4.7 AATAGAACACGTGTTCTTAT
Staphylococcus carnosus subsp. carnosus TM300 Sca_1008 -82 5.2 AACAGAACATTTGTTCTTTA
-53 5.7 ATAAGAACAAATGTTCGCAT
Staphylococcus carnosus subsp. carnosus TM300 Sca_1009 -82 5.2 AACAGAACATTTGTTCTTTA
-53 5.7 ATAAGAACAAATGTTCGCAT
Staphylococcus haemolyticus JCSC1435 SH1545 -81 4.9 TAAAGAACATTAGTTCTTAT
-52 5.8 AAAAGAACAAATGTTCGTAT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1388 -80 5.1 ATTGGAACATTTGTTCTTAT
-51 5.6 AATAGAACATTTGTTCGTAT
Macrococcus caseolyticus JCSC5402 MCCL_1033 -38 5.4 ATAAGAACATACGTTCTATT
-10 4.9 AATAGAACGTATGTTCTGGT
Position: -51
Score: 5.3
Sequence: AATAGAACACATGTTCGTAT
Locus tag: SAOUHSC_02144
SAOUHSC_02144 -51 5.3 AATAGAACACATGTTCGTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA1738
Ortholog function: SPBc2 prophage-derived uncharacterized protein
Staphylococcus aureus subsp. aureus N315 SA1738 -51 5.3 AACAGAACACATGTTCGTAT
Staphylococcus capitis SK14 STACA0001_1975 -52 5.6 AATAGAACAAATGTTCGTAT
Staphylococcus epidermidis ATCC 12228 SE1605 -52 5.6 AACAGAACAAATGTTCGTAT
Staphylococcus carnosus subsp. carnosus TM300 Sca_1497 -59 5.3 TAGCGAACAAGTGTTCGTAT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0868 -51 5.6 AATAGAACGTATGTTCGTAT
Macrococcus caseolyticus JCSC5402 MCCL_1665 -34 5.4 AACAGAACGTACGTTCGTAT
Position: -133
Score: 5.7
Sequence: AACAGAACATATGTTCGTAT
Locus tag: SAOUHSC_02158
SAOUHSC_02158 -133 5.7 AACAGAACATATGTTCGTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA1749
Ortholog function: hypothetical protein
Staphylococcus aureus subsp. aureus N315 SA1749 -133 5.7 AACAGAACATATGTTCGTAT
Staphylococcus capitis SK14 STACA0001_1989 -125 5.3 TATAGAACATATGTTCGCTA
Staphylococcus epidermidis ATCC 12228 SE1627 -127 5.1 AACAGAACGTATGTTCTGTT
Staphylococcus haemolyticus JCSC1435 SH1018 -129 5.9 AAACGAACAAATGTTCGCTT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0853 -135 5.1 AACAGAACGTGTGTTCGTAT
Position: -66
Score: 4.9
Sequence: ACCCGAAAATATGTTCGTGT
Locus tag: SAOUHSC_02424
SAOUHSC_02424 -66 4.9 ACCCGAAAATATGTTCGTGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SA1975
Ortholog function: predicted membrane-bound hydrolase
Staphylococcus aureus subsp. aureus N315 SA1975 -66 4.9 ACCCGAAAATATGTTCGTGT
Staphylococcus capitis SK14 STACA0001_1306 -65 5.2 ACACGAAAGTATGTTCGCTT
Staphylococcus epidermidis ATCC 12228 SE1762 -66 5.1 GTACGAAAGTATGTTCGCAT
Staphylococcus carnosus subsp. carnosus TM300 Sca_1672 -68 5.1 GACCGAAAATATGTTCGTTT
Staphylococcus haemolyticus JCSC1435 SH0869 -66 5.2 CACCGAAAATATGTTCGTAT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0715 -66 5.3 TTACGAAAGTATGTTCGCAT