Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of BirA regulog to Staphylococcus aureus subsp. aureus NCTC 8325

Reference regulog properties
Source regulog: BirA - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: BirA
Regulation mode: repressor
Biological process: Biotin biosynthesis
Effector: Biotin
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus NCTC 8325
Orthologous TF(s) SAOUHSC_01473
Regulated genes 2
Built upon 21 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus NCTC 8325
Locus tag Position Score Sequence
Position: -48
Score: 7.4
Sequence: AATGTTAACAATATGTATTTTAAAGTTTACATT
Locus tag: SAOUHSC_00557
SAOUHSC_00557 -48 7.4 AATGTTAACAATATGTATTTTAAAGTTTACATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yhfT
Ortholog function: putative long chain fatty acid-CoA ligase
Staphylococcus aureus subsp. aureus N315 SA0533 -48 7.1 AATGTTAACAAGATGTATTTTAAAGTTTACATT
Staphylococcus capitis SK14 STACA0001_0458 -43 7.2 AATGTTAACATATTTATAAATATAGTTTACATA
Staphylococcus epidermidis ATCC 12228 SE0344 -44 7.1 AATGTAAACATAATTATATAAAGTGTTTACAAA
Staphylococcus haemolyticus JCSC1435 SH2418 -55 7.6 AATGTTAACATAATATAAAATAAAGTTAACATT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP2146 -49 6.6 AATGTTAACATATTTGTTATGAAGGTTAACAAA
Position: -75
Score: 7.5
Sequence: ATTGTAAACTTTTCATTTCTTAAAGTTTACAAT
Locus tag: SAOUHSC_02552
SAOUHSC_02552 -75 7.5 ATTGTAAACTTTTCATTTCTTAAAGTTTACAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: bioY
Ortholog function: biotin transporter BioY
Staphylococcus aureus subsp. aureus N315 SA2077 -75 7.5 ATTGTAAACTTTTCATTTCTTAAAGTTTACAAT
Staphylococcus capitis SK14 STACA0001_1211 -70 7.8 TATGTAAACTTTTTATTTCTTAAAGTTTACATT
Staphylococcus epidermidis ATCC 12228 SE1856 -70 6.9 ATTGTAAACTTTCCATTCATAAAAGTTTACAAG
Staphylococcus carnosus subsp. carnosus TM300 Sca_1775 -75 7.3 AATGTAAACTTTTAGTAAATTCAAGTTAACAAT
Staphylococcus haemolyticus JCSC1435 SH0770 -69 8.2 AATGTAAACTTTTTATTTTATAAAGTTTACATT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0625 -67 8.1 AATGTAAACTTTTTATTTTTTAAAGTTTACATT
Macrococcus caseolyticus JCSC5402 MCCL_0134 -75 6.7 ATTGTTAACTTTTTGTACTAAAAGGTTAACGAA