Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing SA0184 gene

Properties
Regulog: MurR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode: repressor
Biological process: N-acetylmuramate utilization
Effector: N-acetylmuramate-6-phosphate
Phylum: Firmicutes
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Staphylococcus aureus subsp. aureus N315
Position: -133
Score: 5.41776
Sequence: ATATGTAAGATTATTACAATG
Locus tag: SA0184
Name: SA0184
Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: SA0185
Name: murQ
Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: SA0186
Name: murT
Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: SA0187
Name: murR
Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184-murQ-murT-murR -133 5.4 ATATGTAAGATTATTACAATG SA0184
Staphylococcus capitis SK14
Position: -65
Score: 5.32307
Sequence: AATTGTAAACGTTTAATAATA
Locus tag: STACA0001_1175
Name: SA0184
Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: STACA0001_1174
Name: murQ
Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: STACA0001_1173
Name: murT
Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: STACA0001_1172
Name: murR
Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184-murQ-murT-murR -65 5.3 AATTGTAAACGTTTAATAATA STACA0001_1175
Staphylococcus carnosus subsp. carnosus TM300
Position: -114
Score: 5.56253
Sequence: TATTGTAATAAAATTTCAATT
Locus tag: Sca_2140
Name: SA0184
Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: Sca_2139
Name: murQ
Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: Sca_2138
Name: murT
Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: Sca_2137
Name: murR
Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184-murQ-murT-murR -114 5.6 TATTGTAATAAAATTTCAATT Sca_2140
Staphylococcus epidermidis ATCC 12228
Position: -66
Score: 5.32115
Sequence: AATTGTAAACTTGTTGCAATA
Locus tag: SE1888
Name: SA0184
Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: SE1889
Name: murQ
Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: SE1890
Name: murT
Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: SE1891
Name: murR
Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184-murQ-murT-murR -66 5.3 AATTGTAAACTTGTTGCAATA SE1888
Staphylococcus haemolyticus JCSC1435
Position: -91
Score: 5.64808
Sequence: AATTATAAAAATTATATAATA
Locus tag: SH0743
Name: SA0184
Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: SH0742
Name: murQ
Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: SH0741
Name: murT
Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: SH0740
Name: murR
Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184-murQ-murT-murR -91 5.6 AATTATAAAAATTATATAATA SH0743
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -105
Score: 5.30345
Sequence: ATTTGTAATAAAATTTCATTT
Position: -64
Score: 5.5899
Sequence: AATTGTAATACTTTTTCATAT
Locus tag: SSP0596
Name: SA0184
Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: SSP0595
Name: murQ
Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: SSP0594
Name: murT
Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: SSP0593
Name: murR
Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184-murQ-murT-murR -105 5.3 ATTTGTAATAAAATTTCATTT SSP0596
-64 5.6 AATTGTAATACTTTTTCATAT