Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing hrcA gene

Properties
Regulog: HrcA - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -37
Score: 6.88337
Sequence: TTAGCACTTGAGGTGATAGAGTGCTAA
Locus tag: MCCL_1234
Name: hrcA
Funciton: heat-inducible transcriptional repressor HrcA
Locus tag: MCCL_1233
Name: grpE
Funciton: heat shock molecular chaperone protein GrpE
Locus tag: MCCL_1232
Name: dnaK
Funciton: chaperone protein DnaK
Locus tag: MCCL_1231
Name: dnaJ
Funciton: chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -37 6.9 TTAGCACTTGAGGTGATAGAGTGCTAA MCCL_1234
Staphylococcus aureus subsp. aureus N315
Position: -38
Score: 6.83023
Sequence: TTAGCACTTGAGATAAGTGAGTGCTAA
Locus tag: SA1411
Name: hrcA
Funciton: heat-inducible transcription repressor HrcA
Locus tag: SA1410
Name: grpE
Funciton: heat shock molecular chaperone protein GrpE
Locus tag: SA1409
Name: dnaK
Funciton: chaperone protein DnaK
Locus tag: SA1408
Name: dnaJ
Funciton: chaperone protein dnaJ
hrcA-grpE-dnaK-dnaJ -38 6.8 TTAGCACTTGAGATAAGTGAGTGCTAA SA1411
Staphylococcus capitis SK14
Position: -40
Score: 7.03093
Sequence: TTAGCACTTGAGAGAAAAGAGTGCTAA
Locus tag: STACA0001_1890
Name: hrcA
Funciton: heat-inducible transcription repressor HrcA
Locus tag: STACA0001_1891
Name: grpE
Funciton: heat shock molecular chaperone protein GrpE
Locus tag: STACA0001_1892
Name: dnaK
Funciton: chaperone protein DnaK
Locus tag: STACA0001_1893
Name: dnaJ
Funciton: chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -40 7 TTAGCACTTGAGAGAAAAGAGTGCTAA STACA0001_1890
Staphylococcus carnosus subsp. carnosus TM300
Position: -38
Score: 6.79858
Sequence: TTAGCACTTGAGAGAAGAGAGTGCTAA
Locus tag: Sca_1204
Name: hrcA
Funciton: heat-inducible transcription repressor HrcA
Locus tag: Sca_1203
Name: grpE
Funciton: heat shock molecular chaperone protein GrpE
Locus tag: Sca_1202
Name: dnaK
Funciton: chaperone protein DnaK
Locus tag: Sca_1201
Name: dnaJ
Funciton: chaperone protein dnaJ
hrcA-grpE-dnaK-dnaJ -38 6.8 TTAGCACTTGAGAGAAGAGAGTGCTAA Sca_1204
Staphylococcus epidermidis ATCC 12228
Position: -38
Score: 7.2182
Sequence: TTAGCACTTGAGATAAAAGAGTGCTAA
Locus tag: SE1269
Name: hrcA
Funciton: heat-inducible transcription repressor HrcA
Locus tag: SE1268
Name: grpE
Funciton: heat shock molecular chaperone protein GrpE
Locus tag: SE1267
Name: dnaK
Funciton: chaperone protein DnaK
Locus tag: SE1266
Name: dnaJ
Funciton: chaperone protein dnaJ
hrcA-grpE-dnaK-dnaJ -38 7.2 TTAGCACTTGAGATAAAAGAGTGCTAA SE1269
Staphylococcus haemolyticus JCSC1435
Position: -40
Score: 6.87259
Sequence: TTAGCACTTAGGACAAAAGAGTGCTAA
Locus tag: SH1334
Name: hrcA
Funciton: heat-inducible transcription repressor HrcA
Locus tag: SH1335
Name: grpE
Funciton: heat shock molecular chaperone protein GrpE
Locus tag: SH1336
Name: dnaK
Funciton: chaperone protein DnaK
Locus tag: SH1337
Name: dnaJ
Funciton: chaperone protein dnaJ
hrcA-grpE-dnaK-dnaJ -40 6.9 TTAGCACTTAGGACAAAAGAGTGCTAA SH1334
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -40
Score: 6.9778
Sequence: TTAGCACTTGAAACAAAAGAGTGCTAA
Locus tag: SSP1175
Name: hrcA
Funciton: heat-inducible transcription repressor HrcA
Locus tag: SSP1176
Name: grpE
Funciton: heat shock molecular chaperone protein GrpE
Locus tag: SSP1177
Name: dnaK
Funciton: chaperone protein DnaK
Locus tag: SSP1178
Name: dnaJ
Funciton: chaperone protein dnaJ
hrcA-grpE-dnaK-dnaJ -40 7 TTAGCACTTGAAACAAAAGAGTGCTAA SSP1175