Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing groES gene

Properties
Regulog: HrcA - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -61
Score: 7.12921
Sequence: TTAGCACTATATATAAGAGAGTGCTAA
Locus tag: MCCL_1711
Name: groES
Funciton: chaperonin GroES protein
Locus tag: MCCL_1710
Name: groEL
Funciton: chaperonin GroEL protein
groES-groEL -61 7.1 TTAGCACTATATATAAGAGAGTGCTAA MCCL_1711
Staphylococcus aureus subsp. aureus N315
Position: -54
Score: 6.93658
Sequence: TTAGCACTCTTTAATGTTAAGTGCTAA
Locus tag: SA1837
Name: groES
Funciton: chaperonin GroES protein
Locus tag: SA1836
Name: groEL
Funciton: chaperonin GroEL protein
groES-groEL -54 6.9 TTAGCACTCTTTAATGTTAAGTGCTAA SA1837
Staphylococcus capitis SK14
Position: -54
Score: 7.17723
Sequence: TTAGCACTCTAATAATTAAAGTGCTAA
Locus tag: STACA0001_1993
Name: groES
Funciton: chaperonin GroES protein
Locus tag: STACA0001_1992
Name: groEL
Funciton: chaperonin GroEL protein
groES-groEL -54 7.2 TTAGCACTCTAATAATTAAAGTGCTAA STACA0001_1993
Staphylococcus carnosus subsp. carnosus TM300
Position: -98
Score: 7.59754
Sequence: TTAGCACTCAATAATCAAGAGTGCTAA
Locus tag: Sca_1541
Name: groES
Funciton: chaperonin GroES protein
Locus tag: Sca_1540
Name: groEL
Funciton: chaperonin GroEL protein
groES-groEL -98 7.6 TTAGCACTCAATAATCAAGAGTGCTAA Sca_1541
Staphylococcus epidermidis ATCC 12228
Position: -54
Score: 7.06742
Sequence: TTAGCACTCTATATATCAAAGTGCTAA
Locus tag: SE1630
Name: groES
Funciton: chaperonin GroES protein
Locus tag: SE1629
Name: groEL
Funciton: chaperonin GroEL protein
groES-groEL -54 7.1 TTAGCACTCTATATATCAAAGTGCTAA SE1630
Staphylococcus haemolyticus JCSC1435
Position: -55
Score: 7.03253
Sequence: TTAGCACTCATTATATTTAAGTGCTAA
Locus tag: SH1001
Name: groES
Funciton: chaperonin GroES protein
Locus tag: SH1002
Name: groEL
Funciton: chaperonin GroEL protein
groES-groEL -55 7 TTAGCACTCATTATATTTAAGTGCTAA SH1001
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -56
Score: 7.02447
Sequence: TTAGCACTCATTAACTTAAAGTGCTAA
Locus tag: SSP0847
Name: groES
Funciton: chaperonin GroES protein
Locus tag: SSP0848
Name: groEL
Funciton: chaperonin GroEL protein
groES-groEL -56 7 TTAGCACTCATTAACTTAAAGTGCTAA SSP0847